 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circANKRD36 | |||
| Gene | ANKRD36 | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Type 2 Diabetes Mellitus | ICD-10 | Type 2 diabetes mellitus (E11) |
| DBLink | PMID | 30066828 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | Peripheral blood from patients with T2DM (n=43) and healthy individuals (n=45) |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GGAGGCCACAAGTGATGAGA ReverseCCTGGTGGTTTCTCAGAAGAC | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Fang, Y, Wang, X, Li, W, Han, J, Jin, J, Su, F, Zhang, J, Huang, W, Xiao, F, Pan, Q, Zou, L (2018). Screening of circular RNAs and validation of circANKRD36 associated with inflammation in patients with type 2 diabetes mellitus. Int. J. Mol. Med., 42, 4:1865-1874. | |||